Tool to annotate outfiles from ExpansionHunter with the pathologic implications of the repeat

Clinical-Genomics, updated 🕥 2022-01-21 14:34:39

Stranger Build Status Coverage Status PyPI VersionDOI

Annotates output files from ExpansionHunter with the pathologic implications of the repeat sizes.

Installation

git clone github.com/moonso/stranger cd stranger pip install --editable .

Usage

``` stranger --help Usage: stranger [OPTIONS] VCF

Annotate str variants with str status

Options: -f, --repeats-file PATH Path to a file with repeat definitions. See README for explanation [default: $HOME/stranger /stranger/resources/variant_catalog_grch37.json] -i, --family_id TEXT Family ID used in RankScore output --version --loglevel [DEBUG|INFO|WARNING|ERROR|CRITICAL] Set the level of log output. [default: INFO] --help Show this message and exit.

```

Repeat definitions

The repeats are called with Expansion Hunter as mentioned earlier. ExpansionHunter will annotate the number of times that a repeat has been seen in the bam files of each individual and what repeat id the variant has. Stranger will annotate the level of pathogenicity for the repeat number. The intervals that comes with the package are manually collected from the literature since there is no single source where this information can be collected.

You can find a repeat definitions json file that comes with Stranger here. It is based on the ExpansionHunter variant catalog, but extended with a few disease locus relevant keys:

| Column/Key | Content/Value | | ------- | ------- | | HGNC_ID | HGNC identifier for the repeat or most associated gene. | | HGNC_SYMBOL |HGNC symbol for the repeat or most associated gene. | | REPID | ExpansionHunter repeat ID. | | RU | Basic repeat unit, as seen in ExpansionHunter. Unused. | | DisplayRU | Repeat unit, as clinicians are used to see it. | | Normal_Max | (#copies) Longest repeat expected for normal individual; higher are marked pre- or full-mutation | | Pathologic_Min | (#copies) Shortest repeat expected for pathology. This and higher is annotated as full-mutation. | | Disease | Associated disease. | | InheritanceMode | Mode of inheritance "AR", "AD", "XR" etc | | Source | Reference literature resource type, eg GeneReviews or PubMed | | SourceId | PMID or GeneReviews book ID for references|

Other fields accepted by ExpansionHunter are also encouraged.

For convenience, here is a formated table with some of the current contents:

| HGNCId | LocusId | DisplayRU | InheritanceMode | normal_max | pathologic_min | Disease | SourceDisplay | SourceId | | ------- | ------- | ------- | ------- | ------- | ------- | ------- | ------- | ------- | | 3776 | AFF2 | CCG | XR | 39 | 200 | Fraxe | GeneReviews Internet 2019-11-07 | NBK535148 | | 644 | AR | CAG | XR | 34 | 38 | SBMA | GeneReviews Internet 2019-11-07 | NBK535148 | | 18060 | ARX_EIEE | GCN | XR | 16 | 17 | EIEE | GeneReviews Internet 2019-11-07 | NBK535148 | | 18060 | ARX_PRTS | GCN | XR | 12 | 20 | PRTS | GeneReviews Internet 2019-11-07 | NBK535148 | | 3033 | ATN1 | CAG | AD | 35 | 48 | DRPLA | GeneReviews Internet 2019-11-07 | NBK535148 | | 10549 | ATXN10 | ATTCT | AD | 32 | 800 | SCA10 | GeneReviews Internet 2019-11-07 | NBK535148 | | 10548 | ATXN1 | CAG | AD | 35 | 45 | SCA1 | GeneReviews Internet SCA1 2017-06-22 | NBK1184 | | 10555 | ATXN2 | CAG | AD | 31 | 37 | SCA2 | GeneReviews Internet SCA2 2019-02-14 | NBK1275 | | 7106 | ATXN3 | CAG | AD | 44 | 60 | MJD | GeneReviews Internet 2019-11-07 | NBK535148 | | 10560 | ATXN7 | CAG | AD | 19 | 36 | SCA7 | GeneReviews Internet 2019-11-07 | NBK535148 | | 10561 | ATXN8OS | CTG | AD | 50 | 80 | SCA8 | GeneReviews Internet 2019-11-07 | NBK535148 | | 28337 | C9ORF72 | GGCCCC | AD | 25 | 40 | FTDALS1 | GeneReviews Internet 2019-11-07 | NBK535148 | | 1388 | CACNA1A | CAG | AD | 18 | 20 | SCA6 | GeneReviews Internet 2019-11-07 | NBK535148 | | 1541 | CBL | CCG | AD | 79 | 100 | FRAX11B | Jones et al Nature 1995 | 7603564 | | 1541 | BEAN1 | TGGAA | AD | 10 | 40 | SCA31 | Sato et al AJHG 2009 | 7603564 | | 13164 | CNBP | CCTG | AD | 30 | 75 | DM2 | GeneReviews Internet 2020-03-19 | NBK1466 | | 2482 | CSTB | CCCCGCCCCGCG | AR | 3 | 30 | EPM1 | GeneReviews Internet 2019-11-07 | NBK535148 | | 2482 | DAB1 | ATTTC | AD | 16 | 31 | SCA37 | GeneReviews Internet 2019-05-30 | NBK541729 | | 29284 | DIP2B | CGG | AD | 24 | 270 | FRA12A | GeneReviews Internet 2019-11-07 | NBK535148 | | 2933 | DMPK | CTG | AD | 34 | 50 | DM1 | GeneReviews Internet 2019-10-03 | NBK1165 | | 18683 | EIF4A3 | TCGGCAGCGGCGCAGCGAGG | AR | 9 | 10 | RCPS | GeneReviews Internet 2019-11-07 | NBK535148 | | 3775 | FMR1 | CGG | XR | 55 | 200 | FragileX | GeneReviews Internet 2019-11-07 | NBK535148 | | 1092 | FOXL2 | GCN | AD | 14 | 15 | BPES | GeneReviews Internet 2019-11-07 | NBK535148 | | 3951 | FXN | GAA | AR | 35 | 51 | FRDA | GeneReviews Internet 2019-11-07 | NBK535148 | | 4331 | GLS | GCA | AR | 20 | 90 | GDPAG | van Kuilenburg et al (2019) NEJM 380:1433-1441 | 30970188 | | 5102 | HOXA13_I | GCN | AD | 14 | 22 | HFGS | GeneReviews Internet 2019-08-08 | NBK1423 | | 5102 | HOXA13_II | GCN | AD | 12 | 18 | HFGS | GeneReviews Internet 2019-08-08 | NBK1423 | | 5102 | HOXA13_III | GCN | AD | 18 | 24 | HFGS | GeneReviews Internet 2019-08-08 | NBK1423 | | 5136 | HOXD13 | GCN | AD | 15 | 22 | SDTY5 | GeneReviews Internet 2019-11-07 | NBK535148 | | 4851 | HTT | CAG | AD | 36 | 40 | Huntington | GeneReviews Internet 2020-06-11 | NBK1305 | | 14203 | JPH3 | CTG | AD | 28 | 40 | HDL2 | GeneReviews Internet 2019-06-27 | NBK1529 | | 31708 | LRP12 | CGN | AD | 45 | 90 | OPDM1 | GeneReviews Internet 2019-11-07 | NBK535148 | | 1226 | GIPC1 | GGC | AD | 32 | 73 | OPDM2 | Deng et al (2020) AJHG 106(6):793-804 | 32413282 | | 17043 | NIPA1 | GCN | AD | 8 | 10000 | ALS - susceptibility to | Tazelaar et al (2019) Neurobiol Aging 74:234.e9-234.e15 | 30342764 | | 15911 | NOP56 | GGCCTG | AD | 14 | 650 | SCA36 | GeneReviews Internet 2014-08-07 | NBK231880 | | 53924 | NOTCH2NLC | CGG | AD | 38 | 66 | NIID | GeneReviews Internet 2019-11-07 | NBK535148 | | 8565 | PABPN1 | GCN | AD | 10 | 12 | OPMD | GeneReviews Internet 2014-02-20 | NBK1126 | | 9143 | PHOX2B | GCN | AD | 20 | 25 | CCHS | GeneReviews Internet 2014-01-30 | NBK1427 | | 9305 | PPP2R2B | CAG | AD | 32 | 51 | SCA12 | GeneReviews Internet 2019-11-07 | NBK535148 | | 16854 | RAPGEF2 | TTTCA | AD | 1 | 10 | FAME7 | Ishiura et al (2018) Nature Genetics 50;581-90 | 29507423 | | 9969 | RFC1 | AARRG | AR | 11 | 12 | CANVAS | Cortese et al 2019 Nat Gen PMID: 30926972 | 30926972 | | 31750 | SAMD12 | TTTCA | AD | 1 | 10 | FAME1 | Ishiura et al (2018) Nature Genetics 50;581-90 | 29507423 | | 10472 | RUNX2 | GCN | AD | 17 | 20 | CCD | GeneReviews Internet 2019-11-07 | NBK535148 | | 11199 | SOX3 | GCN | XR | 15 | 22 | MRGH | GeneReviews Internet 2019-11-07 | NBK535148 | | 11588 | TBP | CAN | AD | 40 | 49 | SCA17 | GeneReviews Internet 2019-09-12 | NBK1438 | | 11592 | TBX1 | GCN | AD | 15 | 25 | TOF | GeneReviews Internet 2019-11-07 | NBK535148 | | 11634 | TCF4 | CTG | AD | 39 | 100 | FECD3 | GeneReviews Internet 2019-11-07 | NBK535148 | | 11969 | TNRC6A | TTTCA | AD | 1 | 10 | FAME6 | Ishiura et al (2018) Nature Genetics 50;581-90 | 29507423 | | 15516 | XYLT1 | GGC | AR | 20 | 70 | DBQD2 | LaCroix et al (2018) AJHG 104(1):35-44 | 30554721 | | 12873 | ZIC2 | GCN | AD | 15 | 25 | HPE5 | GeneReviews Internet 2019-11-07 | NBK535148 | | 12874 | ZIC3 | GCN | XR | 10 | 12 | VACTERLX | GeneReviews Internet 2019-11-07 | NBK535148 | | 9179 | POLG | CTG | - | 15 | 10000 | - | Research only. Contact CMMS, KUH, regarding findings. | CMMS |

Stranger can also read a legacy .tsv format file, structured like a Scout gene panel, with STR specific columns. The column names and keys correspond, but if in any kind of doubt, please read the code or use the json version.

As a default the file that follows the distribution is used but the users can create their own file. Header line(s) should be preceded with a #.

It is also possible to use an ExpansionHunter variant catalog json file with corresponding keys added. E.g. [ { "VariantType": "Repeat", "LocusId": "ATXN2", "LocusStructure": "(GCT)*", "ReferenceRegion": "chr12:112036753-112036822", "Disease": "SCA2", "NormalMax": 31, "PathologicMin": 39 }, { "VariantType": "Repeat", "LocusId": "PABPN1", "LocusStructure": "(GCG)*", "ReferenceRegion": "chr14:23790681-23790699", "Disease": "OPMD", "NormalMax": 6, "PathologicMin": 9 } ]

Such files are also provided with the distribution. PRs with updates are much appreciated.

Output

Output is by annotated VCF, with keys STR_STATUS, NormalMax and PathologicMin.

```

INFO=

4 3076603 . C , . PASS END=3076660;REF=19;RL=57;RU=CAG;VARID=HTT;REPID=HTT;STR_STATUS=normal,normal ```

Releases

Catalog patch DAB1, POLG 2021-11-15 17:13:26

  • Fix DAB1 pathologic repeat unit name Update POLG coords, quite a bit on hg38

Ob1 corrections, with a little help from my friends 2021-06-04 19:20:03

[0.8.0]

Off by one error on PathogenticMin output. All affected have at least been cautioned pre_mutation with proper size. Added script to check HGNCId-symbol correspondence against genenames.org. Added script to compare two variant_catalogs and warn on disagreeing field items. Sync min/max between hg19, hg38 for ATN1, DMPK, FMR1 and TBP.Update BEAN1 documentation reference. Update PABPN1 source tag. Update GLS and RFC1 hg19 coordinates (zero based off by one). Update NIPA1 locus definition updating hg19 to the current ExHu one. Update ARX and SOX3 0-based off by one. Usually unproblematic, but gives ugly gap on REViewer alignments. Update HTT PathogenicMin and NormalMax so already reduced penetrance are pathogenic - and mark intermediate pre_mutation. Update pathologic region annotation on (mostly hg38 liftOver) loci affecting alternate region naming for ATXN7, ATXN8OS, FXN, HTT, CNBP, NOP56. Update DAB1 repeat unit (revcomp) and off by one coordinates.

2021-02-18 14:25:12

Increase rank score to get above CG default loading threshold.

Add a family_id option and print to RankScore elements 2021-02-01 11:12:20

  • Add a family_id option and print to RankScore elements

Get a DOI 2019-12-13 19:24:33

This release is created to autogenerate a DOI

The one with limits 2019-11-15 11:54:21

Add normal and pathologic limits for each variant to the VCF.

Clinical Genomics
GitHub Repository